CRISPOR

Mus musculus (mm10), chr4:120715326-120715348, forward genomic strand

Your input sequence is 23 bp long. It contains 1 possible guide sequences.
Shown below are their PAM sites and the expected cleavage position located -3bp 5' of the PAM site.
Click on a match for the PAM NGG below to show its 20 bp-long guide sequence. (Need help? Look at the CRISPOR manual)
Colors green, yellow and red indicate high, medium and low specificity of the PAM's guide sequence in the genome.

Position  0         10        20        
Variants  .......................
Sequence  CGTCTTGTCACCATAGCCAATGG
                           −−−TGG

Download for: SerialCloner (free) - ApE (free) - GenomeCompiler - Benchling - SnapGene - Geneious - Vector NTI - LaserGene - Genbank - FASTA

Predicted guide sequences for PAMs

Ranked by default from highest to lowest specificity score (Hsu et al., Nat Biot 2013). Click on a column title to rank by a score.
If you use this website, please cite our paper in NAR 2018. Too much information? Look at the CRISPOR manual.

Download as Excel tables: Guides / Guides, all scores / Off-targets / Saturating mutagenesis assistant

Position/ Strand	Guide Sequence + PAM + Restriction Enzymes + Variants Only G- Only GG- Only A-	MIT Specificity Score	CFD Spec. score $The CFD specificity score, inspired like guidescan.com, behaves like the MIT specificity score, but it is based on the more accurate CFD off-target model, from <a href='http://www.nature.com/nbt/journal/v34/n2/full/nbt.3437.html'>Doench 2016</a>, which is also used by Crispor to rank the off-targets. The CFD specificity score correlates better than the MIT score with the total off-target cleavage fraction of a guide, see <a target=_blank href='https://www.ncbi.nlm.nih.gov/pmc/articles/PMC6731277/'>Tycko et al, Nat Comm 2019</a> and also the <a target=_blank href='/manual/#faq'>CRISPOR manual</a>.$	Predicted Efficiency Show all scores		Outcome		Off-targets for 0-1-2-3-4 mismatches + next to PAM	Genome Browser links to matches sorted by CFD off-target score exons only chr4 only
				Doench '16	Mor.-Mateos	Out-of-Frame	Lindel
21 / fw	`CGTCTTGTCACCATAGCCAA TGG` `.................... ...` Cloning / PCR primers	79	91	63	61	69	78	0 - 0 - 1 - 5 - 77 0 - 0 - 0 - 0 - 2 83 off-targets	3:exon:Kcnq3 3:exon:Kcnq5 4:intergenic:Sox9-Gm11681 4:intron:Kcnq4 4:intergenic:Gm13577-Gm13576 4:exon:Fam114a1 4:intron:Macrod2 4:intergenic:Ctif-Gm10532 4:intron:Srbd1 4:intergenic:Ccnd1-Tpcn2 4:intron:Raly 4:intergenic:Gm23324-Gm24680 4:intergenic:Siglece-Ctu1 4:intergenic:Caln1-Gm23761 4:intron:Veph1 4:exon:Dlk2/Abcc10 4:intergenic:Wnt5a-Cacna2d3 4:intergenic:Gm14521-Gm14635 4:intergenic:NAMA_1-NAMA_2 4:exon:Elavl2 4:intergenic:Gm26396-Gm13795 3:intergenic:Gm24288-Gm17215 4:intron:Psg17 4:intron:Bbox1 4:exon:Kcnn1 4:intron:Pcdh11x 4:intergenic:Mir874-Klhl3 4:intron:Grb10 3:intergenic:Dcaf12l1-Gm7700 4:exon:Apod 4:intron:Pvrl1 4:intron:Gm8298 4:intergenic:Pdzd4-L1cam 4:intergenic:Gli3-Inhba 4:intergenic:Blmh-Slc6a4 4:intergenic:Ppef1-Gm15242 4:intron:Sptbn1 4:intron:Cgnl1 4:intron:Dtx2 4:intergenic:C230029F24Rik-PCGEM1 4:intergenic:Gm23755-Mylip 4:intergenic:Gm25103-Dph6 4:intergenic:Caln1-Wbscr17 4:intergenic:Ccdc18-Dr1 4:intergenic:Got2-Gm22780 4:exon:Plekhm3 4:intron:Pank1 4:exon:Kcnn3 4:exon:Fbxl12/Ubl5 4:intron:Grip1 4:intergenic:Gm12162-Gm22284 4:exon:Phox2b 4:intergenic:4930564D02Rik-1700095B22Rik 4:intergenic:Gm14077-Macrod2 4:intergenic:Cyp2d9-AC132878.1 4:intron:9130019P16Rik 4:intergenic:Gm26166-Tsc22d2 4:intron:Klhl29 4:intergenic:Mir690-Mb21d2 4:intron:AK129341 4:intron:Rgma 4:exon:Zc3h12b 2:intron:Ncapd3 4:exon:Agbl4 3:intron:D6Wsu163e 4:intergenic:Lmo4-Hs2st1 4:intergenic:Bnip1-Nkx2-5 4:intergenic:Gm25796-Gm23337 4:intergenic:Dpf3-Dcaf4 4:intron:Ddx26b 4:exon:Gjd2 4:intergenic:RP24-378F2.1-RP24-338F2.1 4:intergenic:Gm25884-Gm22582 4:intergenic:Rps7-Rnaseh1 4:intergenic:Acaa1b-Gm10608 4:intergenic:Hspbap1-Gm26838 4:intergenic:Eif3s6-ps1-Gm11995 4:intergenic:RP24-308I2.1-RP24-86O15.2 4:exon:Kmt2d 4:intron:Ube2ql1 4:intergenic:Gm23153-Rps6kc1 4:intron:C030046E11Rik 4:intergenic:1700049L16Rik-Gm9923 Off-target primers show all... show less...

Download as Excel tables: Guides / Guides, all scores / Off-targets / Saturating mutagenesis assistant
Tab-sep format: Guides / Off-targets

New Query

Version 5.01 - Documentation - Contact us - Downloads/local installation - Citation - License