Position 0 10 20 Variants ....................... Sequence CGTCTTGTCACCATAGCCAATGG −−−TGG
Position/ Strand |
Guide Sequence + PAM + Restriction Enzymes + Variants Only G- Only GG- Only A- | MIT Specificity Score | CFD Spec. score | Predicted Efficiency
Show main scores |
Outcome | Off-targets for 0-1-2-3-4 mismatches + next to PAM |
Genome Browser links to matches sorted by CFD off-target score
exons only chr4 only |
||||||||||
---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|---|
21 / fw |
CGTCTTGTCACCATAGCCAA TGG
.................... ... Cloning / PCR primers |
79 | 91 | 63 | 59 | 49 | 0.5 | 0 | 67 | 59 | 61 | 31 | 68 | 69 | 78 |
0 - 0 - 1 - 5 - 77
0 - 0 - 0 - 0 - 2 83 off-targets |
show all... |